2019-02-14 12:09:562025-05-12 04:43:43

description

low affinity potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component

glutamate-controlled potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component

locus

BSU14510

BSU_14510

product

low affinity potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component

glutamate-controlled potassium channel [[protein|KtrC]]-[[protein|KtrD]], peripheric membrane component

outlinks

bsu

BSU14510

BSU_14510

The protein

Kinetic information

the [[protein|KtrC]]-[[protein|KtrD ]]channel has a low affinity for potassium,this is determined by [[protein|KtrD]] [pubmed|30753894]

the [[protein|KtrC]]-[[protein|KtrD ]]channel has a low affinity for potassium, this is determined by [[protein|KtrD]] [pubmed|30753894]

the affinity of [[protein|KtrC]]-[[protein|KtrD]] for potassium is strongly increased in the presence of glutamate (from 0.278 mM to 0.17 mM) [pubmed|32253343]

The protein

[SW|Domains]

contains a [SW|RCK_N domain] at the N-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])

contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]

contains a [SW|RCK_N domain] at the N-terminus (aa 4-126)(according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])

contains a c-di-AMP-binding [SW|RCK_C domain] at the C-terminus (aa 135-219) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt]) [Pubmed|23671116]

The protein

Effectors of protein activity

binds ADP and ATP [pubmed|30753894]

the protein binds c-di-AMP, K_D = 30 nM [Pubmed|30753894]

binds ADP and ATP [pubmed|30753894]

the protein binds c-di-AMP, K_D = 30 nM, this results in inhibition of potassium uptake [Pubmed|30753894]

the affinity of [[protein|KtrC]]-[[protein|KtrD]] for potassium is strongly increased in the presence of glutamate [pubmed|32253343]

The protein

Structure

[PDB|4J7C] (the [[protein|KtrA]]-[[protein|KtrB]] complex, 56% identity) [Pubmed|23598340]

[PDB|4XTT] (the ''S. aureus'' KtrA [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]

[PDB|4J7C] (the [[protein|KtrA]]-[[protein|KtrB]] complex, 56% identity) [Pubmed|23598340]

[PDB|6I8V] ([[protein|KtrC]] in complex with ATP) [Pubmed|30753894]

[PDB|4XTT] (the ''S. aureus'' [[protein|KtrA]] [SW|RCK_C domain] in complex with c-di-AMP, 57% identity) [Pubmed|25957408]

Biological materials

Mutant

MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]

GHB6 ([[gene|ktrC]]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jrg Stlke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955

GP2264 ([[gene|ktrC]]::''aphA3''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]

GP2048 ([[gene|ktrC]]::''cat''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]

GP2079 ([[gene|ktrC]]::''tet''), available in [SW|Jrg Stlke]'s lab [pubmed|28420751]

BKE14510 ([[gene|ktrC]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC

BKK14510 ([[gene|ktrC]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTGGTGCTCCTTTATA, downstream forward: _UP4_TAGCAGCCAAATAAGCCGTC

MGNA-A904 (ykqB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/904 NBRP B. subtilis, Japan]

GHB6 ([[gene|ktrC]]::''spec''), [Pubmed|12562800] (available in [SW|Erhard Bremer]'s and [SW|Jörg Stülke]'s) labs, available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A955&Search=1A955 BGSC] as 1A955

GP2264 (''Δ''''[[gene|ktrC]]''::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2048 (''Δ''''[[gene|ktrC]]''::''cat''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2079 (''Δ''''[[gene|ktrC]]''::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2771 (''Δ''''[[gene|ktrC]]''::''spec''), available in [SW|Jörg Stülke]'s lab

Biological materials

Expression vectors

pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jrg Stlke]'s lab

pGP2907 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

References

Reviews

25869574, 27935846, 25838295

25869574, 27935846, 25838295, 31361596, 32472931, 32603625

References

Original publications

12562800, 23671116, 23598340, 28420751, 28504641

12562800, 23671116, 23598340, 28420751, 28504641, 30753894, 31061098, 31506295, 32253343

Labs working on this gene/protein

[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

The protein

Protein family

KtrA potassium transport family (with [[protein|KtrA]], according to UniProt)

Biological materials

Expression vector

pGP2994: expression of Strep-KtrC in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP380]), available in [SW|Jörg Stülke]'s lab

pGP2995: expression of KtrC-Strep in B. subtilis suitable for [SW|SPINE] (based on [SW|pGP382]), available in [SW|Jörg Stülke]'s lab

labs

[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]

[SW|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]

[SW|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]

[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]